Das deutsche Python-Forum

Code: Alles auswählen

class DNA:
	...
	def __init__(self, s, out=sys.stdout):
		"""Create DNA instance initialized to string s."""
		self.out = out
		s="".join([x.strip() for x in s.split(' ')]) #erase whitespace
		self.seq = s.upper()
		check = self.check_format() #Methode zum Testen ob das Inputformat
									#eingehalten wurde
		if not check:
			raise IOError
	...
	
	#Funktion ohne bes. Wert - nur zum Testen
	def __add__(self,other):
		"""concatenating DNA objects and return DNA object"""
		return DNA(self.seq + other.seq)
		
	...

Code: Alles auswählen

import unittest
	class TestDNAFunctions(unittest.TestCase):
		...
		def setUp(self):
			self.name1 = DNA('ATGCATGCATGC')
			self.name2 = DNA('TGAATGCATGCATGCTTGT')
			
		...
		
		def test__add__(self):
			"""__add__ should concatenate DNA-objects and return them as an DNA-object"""
			r = 'ATGCATGCATGCTGAATGCATGCATGCTTGT'
			self.assertEqual((self.name1 + self.name2),DNA(r))
		
		...

Code: Alles auswählen

...
======================================================================
FAIL: __add__ should concatenate DNA-object and return them as an DNA-object
----------------------------------------------------------------------
Traceback (most recent call last):
  File "src/DNA.py", line 840, in test__add__
    self.assertEqual((self.name1 + self.name2),DNA(r))
  File "/System/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/unittest.py", line 292, in failUnlessEqual
    raise self.failureException, \
AssertionError: ATGCATGCATGCTGAATGCATGCATGCTTGT != ATGCATGCATGCTGAATGCATGCATGCTTGT

----------------------------------------------------------------------
...

Code: Alles auswählen

    def __eq__(self, other):
        return self.seq == other.seq

Code: Alles auswählen

======================================================================
ERROR: check_partly_palindromic should return the palindromic stretch and its position in a dict
----------------------------------------------------------------------
Traceback (most recent call last):
  File "src/DNA.py", line 896, in testCheckPartlyPalindromic
    self.assertEqual(DNA('aATGCATg').check_partly_palindromic(),{'ATGCAT': 2})
  File "src/DNA.py", line 456, in check_partly_palindromic
    if len(j) == minimum: checklist[j] = x+i+1
TypeError: unhashable instance

======================================================================
FAIL: __add__ should concatenate DNA-object and return them as an DNA-object
----------------------------------------------------------------------
Traceback (most recent call last):
  File "src/DNA.py", line 840, in test__add__
    self.assertEqual((self.name1 + self.name2),DNA(r))
  File "/System/Library/Frameworks/Python.framework/Versions/2.3/lib/python2.3/unittest.py", line 292, in failUnlessEqual
    raise self.failureException, \
AssertionError: ATGCATGCATGCTGAATGCATGCATGCTTGT != ATGCATGCATGCTGAATGCATGCATGCTTGT

----------------------------------------------------------------------

Code: Alles auswählen

def check_partly_palindromic(self, minimum = 6):
	...
	s = self.seq
	returnlist = {}
	checklist = {}
	for x in xrange(0,len(s)):
		for i in xrange(1,len(s)+1):
			j = DNA(s[x+i:x+i+minimum])
			if len(j) == minimum: checklist[repr(j)] = x+i+1
		#increase in even steps, otherwise the sequence is not symmetric and 
		#per definition not palindromic
		minimum += 2 
		if minimum > len(s): break
	for y in checklist:
		#gefaellt mir nicht, weil langsam:
		if DNA(y).check_palindromic(): returnlist[y] = checklist[y]	
	return returnlist

Code: Alles auswählen

#check_palindromic() ist die "Schwesterfunktion von check_partly_palindromic()
def testCheckPalindromic(self):
	"""check_palindromic should return a boolean value (palindromic or not?)"""
	self.assert_(DNA('ATGCAT').check_palindromic())
		
def testCheckPartlyPalindromic(self):
	"""check_partly_palindromic should return the palindromic stretch and its position in a dict"""
	self.assertEqual(DNA('aATGCATg').check_partly_palindromic(),{'ATGCAT': 2})

Code: Alles auswählen

j = DNA(s[x+i:x+i+minimum])

Code: Alles auswählen

assert "ATGCATGCATGCTGAATGCATGCATGCTTGT" != "ATGCATGCATGCTGAATGCATGCATGCTTGT"