Die Suche ergab 23 Treffer

von skanami
Mittwoch 2. Januar 2008, 16:22
Forum: Allgemeine Fragen
Thema: Console Fenster in Windows ersetzen durch Graphik (z.B. GIF)
Antworten: 1
Zugriffe: 370

Console Fenster in Windows ersetzen durch Graphik (z.B. GIF)

Hallo, hab da ne vielleicht einfache Frage, wie kann man denn ein Pythonprogramm so schreiben dass man (sobald er den algorithmus rechnet) kein Console Fenster sieht. Ich würd gern dieses Console Fenster durch eine animierte GIF Datei ersetzten die im Mittelpunkt des Bildschirms erscheint und versch...
von skanami
Montag 26. November 2007, 11:30
Forum: Allgemeine Fragen
Thema: String in Blöcke teilen und in eine Liste einfügen
Antworten: 5
Zugriffe: 1112

Jau, besten Dank, klappt.
Noch ne kurze Frage. Gib es bei listen auch eine Funktion wo man einen Item direkt austauschen kann ? wie beim String das replace ? hab im Tutorial von Rossum nichts dazu finden können.
von skanami
Montag 26. November 2007, 10:15
Forum: Allgemeine Fragen
Thema: String in Blöcke teilen und in eine Liste einfügen
Antworten: 5
Zugriffe: 1112

Achja, natürlich erstelle ich durch die 3 Zeilen noch nicht die fertige Liste aber wenn ich das hinbekomme, würde ich es einfach durch den .split("**") Befehl machen
von skanami
Montag 26. November 2007, 10:13
Forum: Allgemeine Fragen
Thema: String in Blöcke teilen und in eine Liste einfügen
Antworten: 5
Zugriffe: 1112

String in Blöcke teilen und in eine Liste einfügen

Hallo allerseits, ich sitze mittlerweile seit 2 tagen frustriert an einem kleinen Problem, und zwar einen String wie z.B. "AGTCCCGGTAAAGCGTAGTGCAGACGATT" in eine Liste zu überführen die dann so aussieht : ['AGT', 'CCC', 'GGT', 'AAA', 'GCG', ...usw. ich habs meistens mit einer normalen for schleife v...
von skanami
Donnerstag 22. November 2007, 15:01
Forum: Offtopic
Thema: .EXE über WinForms aufrufen!
Antworten: 3
Zugriffe: 1642

Es öffnet sich nach dem Klicken des Buttons das winshell fenster aber gibt einen I/O Fehler aus. Die Datei tagware.xml wird nicht gefunden (No such file or directory "tagware.xml") Die Exe datei wird schon gestartet, Es handelt sich um ein Script in Python welches für mich String informationen aus e...
von skanami
Dienstag 20. November 2007, 14:41
Forum: Offtopic
Thema: .EXE über WinForms aufrufen!
Antworten: 3
Zugriffe: 1642

.EXE über WinForms aufrufen!

Hallo, ich hab da mal ne Frage die eigentlich eher indirekt was mit Python zu tun, nun ja fast garnicht. Ich hab nun mein Python script geschrieben welches XML Dateien mit Einträgen aus anderem Formaten erstellt. nun will ich diese ins .exe Format uebersetzen und über Windows Forms aus dem Visualstu...
von skanami
Dienstag 13. November 2007, 15:01
Forum: Allgemeine Fragen
Thema: Mehrere FASTA-Dateien gleichzeitig öffnen
Antworten: 5
Zugriffe: 915

Jo habs hinterher noch geschnallt. thx
hab aber auch rausgefunden dass hinter biopython noch weitere methoden bereitstehen die das ganze vereinfachen. Falls hier jemand sich gut mit biopython auskennt...würde ich gerne die threads lesen.
von skanami
Montag 12. November 2007, 21:04
Forum: Allgemeine Fragen
Thema: Mehrere FASTA-Dateien gleichzeitig öffnen
Antworten: 5
Zugriffe: 915

jo eingabe habe ich nur eingefügt damit sich das programm einfach nur nach eingabe startet. sequenz ist überflüssig stimmt auch. aber wieso gibt es so eine datei ganz bestimmt nicht? in meiner Datei sollte das stehen was ich erwarte und das tuts auch, ist schliesslich nur ne text datei und fliste is...
von skanami
Montag 12. November 2007, 20:12
Forum: Allgemeine Fragen
Thema: Mehrere FASTA-Dateien gleichzeitig öffnen
Antworten: 5
Zugriffe: 915

Mehrere FASTA-Dateien gleichzeitig öffnen

Hallo an alle, kennt sich jemand mit BioPython aus? Hab da folgendes Problem: Ich möchte den Inhalt von mehreren Dateien gleichzeitig bzw. mit einem Klick (soll über ein Button von Win.Forms gestartet werden) öffnen und mit dessen String-Inhalten operieren. Leider erhalte ich folgendes Ergebnis : >>...
von skanami
Montag 12. November 2007, 15:23
Forum: Allgemeine Fragen
Thema: Strings schneiden und in eine Liste einfügen
Antworten: 5
Zugriffe: 998

Jau, da ich im TXT File eh nur eine Zeile hab, hab ichs nun readline() genannt klappt nun. Danke !
von skanami
Montag 12. November 2007, 15:05
Forum: Allgemeine Fragen
Thema: Strings schneiden und in eine Liste einfügen
Antworten: 5
Zugriffe: 998

natürlich nicht entry.split() sondern str.split() oder auch verkehrt?
von skanami
Montag 12. November 2007, 14:59
Forum: Allgemeine Fragen
Thema: Strings schneiden und in eine Liste einfügen
Antworten: 5
Zugriffe: 998

s.split() hab ich bereits angewendet aber es kommt ne fehlermeldung daraufhin. so sieht mein source code aus : def fastaread() : eingabe = raw_input("asfs") f = open("d:\\FastaFiles.txt") entry = f.readlines() fliste = entry.split("_*_") print fliste fastaread() und das ist die fehlermeldung. fliste...
von skanami
Montag 12. November 2007, 14:27
Forum: Allgemeine Fragen
Thema: Strings schneiden und in eine Liste einfügen
Antworten: 5
Zugriffe: 998

Strings schneiden und in eine Liste einfügen

Hallo, weiss jemand wie man aus einem TXT File, worin sich Pfadinformation als einen langen String vorliegen. in eine Liste eingefügt werden kann ? Wenn ich bei Python einen String in eine Liste einfügen will muss ich doch nur angeben zwischen welchen Positionen der string ausgeschnitten und als ein...
von skanami
Freitag 9. November 2007, 17:15
Forum: Allgemeine Fragen
Thema: Python und Visual C#. ---> IRONPyton?
Antworten: 7
Zugriffe: 1349

mmh nehmen wir an ich schreibe einen algorithmus in python und lass sie in eine .exe datei also auch plattformunabhängige form (oder net) uebersetzen. kann ich dann diese anwendungsdateien in win.Forms einbinden dass ich beispielsweise die berechnungen aus meinem Algorithmus durch c# graphish darges...
von skanami
Mittwoch 7. November 2007, 22:51
Forum: Installation/Konfigurieren
Thema: Brauche Pygraphviz! Aber wie installier ich ?
Antworten: 1
Zugriffe: 2383

Brauche Pygraphviz! Aber wie installier ich ?

Hallo, ich möchte pygraphviz benutzen, womit sich laut tutorials gut Baumgraphen erstellen lassen. nun hab ich stundenlang rumgesucht welche Dateien ich denn nun jetzt brauch und wie meine Python entwicklungsumgebung (IDLE) bzw. die Console das modul findet und dessen methoden importieren kann. Hat ...